A few people have asked me if the current SARs-CoV-2 primers hit SARs 2003?

This is a tutorial on how to BLAST these yourself to address such questions.

There are many primer pairs in use so this analysis only contemplates the primers on the CDC website.
These are the CDC primers.
I believe these are the same primers for sale @idtdna

It would be really helpful if these were on IDTs website as there was news about CDCs initial SARs primers having contamination issues.

https://www.cdc.gov/coronavirus/2019-ncov/lab/rt-pcr-panel-primer-probes.html">https://www.cdc.gov/coronavir...
They fit in a tweet.
>2019-nCoV_N1-F
GACCCCAAAATCAGCGAAAT
>2019-nCoV_N1-R
TCTGGTTACTGCCAGTTGAATCTG
>2019-nCoV_N1-P
ACCCCGCATTACGTTTGGTGGACC
>2019-nCoV_N2-F
TTACAAACATTGGCCGCAAA
>2019-nCoV_N2-R
GCG CGA CAT TCC GAA GAA
>2019-nCoV_N2-P
ACAATTTGCCCCCAGCGCTTCAG
Its important to buy the positive controls and the exclusion controls.
Note the SARs1 exclusion control is NOT SARs1. Its RatG13 from the bat. This is not SARs1 from 2003.
Your C19 assay should not amplify the exclusion controls and I have personally tested this and it is true.

But what about SARs1? Conspiracy right?

Lets check.

First you need to download some Sequence files and IDT kindly provides them or links to them.
Download the Plasmid control maps.

These don& #39;t contain the whole virus but a subset of it that the primers target. They are in a plasmid as that is a DNA xerox machine if you put it into E.coli.
Infinitely replicable product. Pretty cool. Not Infectious.
This plasmid control map is a Zip file and also has the Fasta file in a PDF format. You& #39;ll need to copy and paste this sequencing into a Text file. Sublime is good text editor for this.
You can follow @Kevin_McKernan.
Tip: mention @twtextapp on a Twitter thread with the keyword “unroll” to get a link to it.

Latest Threads Unrolled: